The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2-0-rnethoxyethyl modifications, has nucleotides 5-17 which are 2deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma.La présente invention concerne un procédé de fourniture dune thérapie antisens qui réduit lexpression de clusterine pour fournir un effet bénéfique thérapeutique dans le traitement du cancer, comprenant ladministration dun oligonucléotide anti-clusterine possédant la séquence CAGCAGCAGAGTCTTCATCAT (Séq. ID No. : 1), loligonucléotide anti-clusterine possédant un squelette phosphorothioate le traversant, possédant des fragments sucre de nucléotides 1 à 4 et 18 à 21 portant des modifications 2-O-méthoxyéthyle, possédant des nucléotides 5 à 17 qui sont des désoxynucléotides 2, et possédant des 5-méthylcytosines aux nucléotides 1, 4 et 19, à un sujet humain nécessitant un traitement pour le cancer, lequel sujet humain reçoit également au moins un agent chimiothérapeutique, une thérapie dablation dhormones, ou une radiothérapie, loligonucléotide anti-clusterine étant administré au moins 3 fois au cours dune période de 5 à 9 jours, au moins 1 des administrations étant à une posologie autre que 640
