A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti- clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 -O-methoxyethyl modifications, has nucleotides 5-17 which are 2 deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.La présente invention concerne une méthode de traitement dun patient humain atteint dun cancer du poumon. Ladite méthode inclut ladministration périodique audit patient humain dune chimiothérapie, comprenant une quantité dun taxane et 640 mg dun oligonucléotide anti-clustérine présentant la séquence CAGCAGCAGAGTCTTCATCAT (séq. ID No. : 1). Ledit oligonucléotide anti-clustérine possède : un squelette phosphorothioate dun bout à lautre des fragments de sucre des nucléotides 1 à 4 et 18 à 21 comportant des modifications 2-O-méthoxyéthyle des nucléotides 5 à 17 qui sont 2désoxynucléotides et des 5-méthylcytosines au niveau des nucléotides 1, 4, et 19, ce qui permet de traiter ledit patient humain atteint dun cancer du poumon.
