A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti- clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 ' -O-methoxyethyl modifications, has nucleotides 5-17 which are 2 ' deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.La présente invention concerne une méthode de traitement d'un patient humain atteint d'un cancer du poumon. Ladite méthode inclut l'administration périodique audit patient humain d'une chimiothérapie, comprenant une quantité d'un taxane et 640 mg d'un oligonucléotide anti-clustérine présentant la séquence CAGCAGCAGAGTCTTCATCAT (séq. ID No. : 1). Ledit oligonucléotide anti-clustérine possède : un squelette phosphorothioate d'un bout à l'autre ; des fragments de sucre des nucléotides 1 à 4 et 18 à 21 comportant des modifications 2'-O-méthoxyéthyle ; des nucléotides 5 à 17 qui sont 2'désoxynucléotides ; et des 5-méthylcytosines au niveau des nucléotides 1, 4, et 19, ce qui permet de traiter ledit patient humain atteint d'un cancer du poumon.