The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel and 640mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (SEQ ID NO: 1 ), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2-0-methoxyethyl modifications, has nucleotides 5-17 which are 2deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.La présente invention concerne des procédés pour traiter un patient humain atteint de cancer du poumon non à petites cellules non résécable, avancé ou métastasique comprenant ladministration périodique au patient humain dune chimiothérapie comprenant une quantité de docétaxel et 640 mg dun oligonucléotide anti-clustérine ayant la séquence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), loligonucléotide anti-clustérine ayant intégralement un squelette phosphorothioate, ayant des fragments glucidiques de nucléotides 1-4 et 18-21 comportant des modifications 2-O-méthoxyéthyle, ayant des nucléotides 5-17 qui sont des 2-désoxynucléotides, et ayant des 5-méthylcytosines aux nucléotides 1, 4, et 19, de manière à traiter le patient humain atteint de cancer du poumon non à petites cellules non résécable, avancé ou métastasique. La présente invention concerne en outre des compositions et des combinaisons, des emballages, et des utilisations de ceux-ci pour traiter un patient humain atteint de cancer du poumon non à petites cellules non résécable
