The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1). Additionally, the present invention provides provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti- clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No. : 1), wherein the anti- clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 -O-methoxyethyl modifications, has nucleotides 5-17 which are 2 deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.Cette invention concerne une méthode de traitement du cancer chez un sujet atteint de cancer comprenant ladministration au sujet dun oligonucléotide anti-clustérine en tant que monothérapie pour traiter le cancer. Cette invention concerne également des compositions pour traiter le cancer chez un sujet atteint de cancer, comprenant un oligonucléotide anti-clustérine ayant la séquence CAGCAGCAGAGTCTTCATCAT (Séq. ID No. : 1). De plus, cette invention concerne des compositions pharmaceutiques pour traiter le cancer chez un sujet atteint de cancer, la composition comprenant un oligonucléotide anti-clustérine ayant la séquence CAGCAGCAGAGTCTTCATCAT (Séq. ID No. : 1), loligonucléotide anti-clustérine ayant un squelette entièrement phosphorothioate, des fragments sucre constitués par les nucléotides 1-4 et 18-21 portant des modifications 2-O-méthoxyéthyle, des nucléotides 5-17 qui sont des 2-désoxynucléotides, et des 5-méthylcytosines sur les nucléotides 1, 4, et 19.
