Claim 1: antisense oligonucleotide of between 10 and 30 nucleotides in length,In the antisense oligonucleotide as a Target Nucleic Acid htra1 and covers a region of contiguous nucleotides between 10 and 22 nucleotides, that is at least 90%As 100%, complementary to the SEC ID no. 147: SEC ID no. 147: ccaacaaccaggtaaatatttg 5 3.Claim 2: antisense oligonucleotide according to claim 1 or 2,The region is identical to a contiguous Nucleotide sequence present in a sequence selected from the group consisting of sec id no. 138, 139, 140, 141, 142, 143,144 and 145: SEC ID no. 138: caaatatttacctggttg SEC ID no. 139: tttacctggttgttgg SEC ID no. 140: ccaaatatttacctggtt SEC ID no. 141: ccaaatatttacctggttgt SEC ID no. 142: atatttacctggttgttg SEC ID no. 143: tatTtacctggttgtt SEC ID no. 144: atatttacctggttgt SEC ID no. 145: atatttacctggttgtt.Claim 12: pharmaceutical composition comprising the antisense oligonucleotide in claims 1 to 10 or the conjugate according to claim 11 and a diluent, Carrier, solvent,Salt and \/ or pharmaceutically acceptable adjuvant.Oligonucleotide according to claim 17: Use of any of claims 1 to 10 or the conjugate according to claim 11 or Pharmaceutical composition according to claim 12,For the preparation of a Medicament for the Treatment or prevention of a disease selected from the group consisting of macular degeneration (such as Wet AMD, Dry AMD,Geographic atrophy, dmaed Intermediate, Diabetic Retinopathy), Parkinsons disease, Alzheimers disease, Duchenne Muscular Dystrophy, arthritis,Such as Osteoarthritis and Inherited Small vessel Ischemic Disease of the Brain.Reivindicación 1: Oligonucleótido antisentido de entre 10 y 30 nucleótidos de longitud, en el que dicho oligonucleótido antisentido presenta como diana un ácido nucleico de HTRA1 y comprende una región de nucleótidos contigua de entre 10 y 22 nucleótidos, que es por lo menos 90%, tal como 100%, complementaria respecto a la SEC ID nº 147: SEC ID nº 147: 5’ CCAACAACCAGGTAAATATTTG 3’. Reivindicaci