Abstract "Method for Treatment of Non-Small Cell Lung Cancer" The present invention provides methods for treating a human patient suffering from unresectable, advanced or metastatic non-small cell lung cancer comprising periodic administration to the human patient of chemotherapy comprising an amount of docetaxel； and 640 mg of an anti-clusterin oligonucleotide having the sequence cagcagcagagtcttcatcat (seq. id: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate framework along it, having 1-4 nucleotide sugar moieties. and 18-21 harboring modifications of 2'-o-methoxyethyl, have nucleotides 5-17 which are 2'-deoxynucleotides and have 5-methylcytosines in nucleotides 1, 4 and 19 thus treating the human patient suffering from cancer. of unresectable, advanced or metastatic non-small cell lung. The present invention also provides compositions and combinations, packaging, and uses thereof, for the treatment of a human patient suffering from unresectable, advanced or metastatic non-small cell lung cancer.resumo “método para tratamento de câncer de pulmão de célula não pequena” a presente invenção fornece métodos para o tratamento de um paciente humano que sofre de câncer de pulmão de célula não pequena irressecável, avançado ou metastático que compreende a administração periódica ao paciente humano de quimioterapia que compreende uma quantidade de docetaxel； e 640 mg de um oligonucleotídeo anti-clusterina que possui a sequência cagcagcagagtcttcatcat (id. de seq. nº: 1), em que o oligonucleotídeo anti-clusterina possui um arcabouço de fosforotioato ao longo dele, possui porções de açúcar de nucleotídeos 1-4 e 18-21 que abrigam modificações de 2’-o-metoxietil, possui nucleotídeos 5-17 que são 2’-desoxinucleotídeos e possui 5-metilcitosinas nos nucleotídeos 1, 4 e 19 tratando, dessa forma, o paciente humano que sofre de câncer de pulmão de célula não pequena irressecável, avançado ou metastático. a presente invenção também fornece composições e combinaçõe
