A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2&prime；-O-methoxyethyl modifications, has nucleotides 5-17 which are 2&prime； deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.
