The present invention provides an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence TCATCATTTTGTCATTTTGTCATT, that has the ability to stimulate the immune response of animals including humans. The stmulation of the immune response is characterized by stimulation of proliferation, differentiation, cytokine production and antibody production in B-cells and cell differentiation and cytokine production in plasmacytoid dendritic cells. The present invention further provides a pharmaceutical composition comprising said immunostimulatory oligonucleotide.