598702 Disclosed is the use of an antisense oligonucleotide for preparation of a medicament for treating pathologies or deficiencies that are characterized by a loss, lack, or underproduction of collagen, wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to a miR-29a (uagcaccaucugaaaucggu), miR-29b (uagcaccauuugaaaucagu), or miR-29c (uagcaccauuugaaaucggu) sequence. Further disclosed is the use of an antisense oligonucleotide for preparation of a medicament for increasing collagen deposition in a tissue for treatment of natural aging and stretch marks. Further disclosed is a composition formulated for topical administration comprising a pharmaceutically acceptable carrier and an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a, miR-29b, and/or miR-29c sequence.
