Provided is a siRNA composition for treating viral hepatitis B. The composition comprises a siRNA sequence group and other components. A positive-sense strand sequence of the siRNA sequence group is CCGUGUGCACUUCGCUUCA[dT][dT], and an antisense strand sequence of the siRNA sequence group is UGAAGCGAAGUGCACACGGUC and the other components comprise T2C1 compounds shown in the following structural formula, wherein the weight ratio of the siRNA sequence group to the other components is 1:(2-40).