A method for the treatment of a Human Patient affected Lung Cancer comprising administering to the Human Patient regular chemotherapy that includes a quantity of a Taxane and 640 mg of an oligonucleotide with anti Clusterin (cagcagcagagtcttcatcat sequence Q id no. 1).The oligonucleotide phosphorothioate anti Clusterin has a Skeleton in all its extension, presents the nucleotide Sugars in units of 1 - 4 and 18 - 21 with modifications - 2 '- or 5 - 17 metoxietilo, Nucleotides and deoxynucleotides are 2', 5 - Nucleotides in the metilcitosinas 1, 4 and 19.reivindicaci u00f3n 2: the method of claim 1, wherein the Taxane paclitaxel is.Claim 8: Method of claim 7, wherein the Taxane is docetaxel. The Method of claim 13: any of claims 1 to 12, where chemotherapy also comprises an amount of a Platinum based chemotherapeutic Agent.Claim 45: a composition for the treatment of a Human patient with non-small cell lung cancer or metastatic unresectable, Advanced, which includes a Taxane chemotherapy consisting of a and, Optionally, a Platinum based chemotherapeutic agent； And an oligonucleotide with anti Clusterin cagcagcagagtcttcatcat sequence (SEQ ID no. 1)Where the oligonucleotide phosphorothioate anti Clusterin has a Skeleton in all its extension, has groups of Sugar nucleotides 1 - 4 and 18 - 21 amendments containing 2 '- O - metoxietilo has 17 5 - Nucleotides and deoxynucleotides are 2', 5 - and metilcitosinas N nucleotides 1, 4 and 19.Un método para el tratamiento de un paciente humano afectado de cáncer de pulmón que comprende administrar periódicamente al paciente humano una quimioterapia que comprende una cantidad de un taxano y 640 mg de un oligonucleótido anti-clusterina que tiene la secuencia CAGCAGCAGAGTCTTCATCAT (SEQ ID Nº 1). El oligonucleótido anti-clusterina tiene un esqueleto fosforotioato en toda su extensión, presenta unidades de azúcares en los nucleótidos 1 - 4 y 18 - 21 con modificaciones 2’-O-metoxietilo, los nucleótidos 5 - 17 que son 2’ desoxinucleótidos
