An antigen and an immunostimulating oligonucleotide comprising the nucleotide sequence 5 'TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO: 1), for use in a method for inducing a specific immune response of antigen in a subject in need thereof, said method comprising administration to a subject of said antigen and said immunostimulatory oligonucleotide in an amount effective to induce an antigen specific immune response in said subject.Un antígeno y un oligonucleótido inmunoestimulante que comprende la secuencia de nucleótido 5' TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO: 1), para su uso en un procedimiento para inducir una respuesta inmunitaria específica de antígeno en un sujeto que necesita el mismo, comprendiendo dicho procedimiento la administración a un sujeto de dicho antígeno y dicho oligonucleótido inmunoestimulante en una cantidad eficaz para inducir una respuesta inmunitaria específica de antígeno en dicho sujeto.
