The present invention is directed to provide nucleic acid molecules that promote proliferation of pancreatic islet β-cells. A proliferation promoting agent for promoting proliferation of pancreatic islet β-cells according to the present invention contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or a nucleic acid molecule having SEQ ID NO: 2:UAAAGUGCUGACAGUGCAGAU (SEQ ID NO: 1)AGCUACAUCUGGCUACUGGGUCUC (SEQ ID NO: 2).