The present invention provides a kind of vertebrate through gene modification, due to the feeling for excessively indicating and having enhancing of predetermined odorant receptor. By introducing DNA come vertebrate described in gene modification, the DNA includes at least four of sequence continuously repeating, and the primary structure and ACATAACTTTTTAATGAGTCT (SEQ ID NO:1) at least 90% of the sequence are homologous. The DNA indicates neighbouring odorant receptor coded sequence excessively with term single gene selection mode relative to the corresponding vertebrate without the DNA.