The present invention provides a single-stranded nucleic acid molecule of the following (A) or (B), containing a TGF-²1 gene expression inhibitory sequence shown in the following SEQ ID NO: 1 or 2: (SEQ ID NO: 1) 5'- AUUUCGUUGUGGGUUUCCACC -3' (SEQ ID NO: 2) 5'- UGUUAUCCCUGCUGUCACAGG -3' (A) a single-stranded nucleic acid molecule consisting of region (X), linker region (Lx) and region (Xc) alone, wherein the region (Xc), the linker region (Lx) and the region (X) are configured in this order from the 5'-side to the 3'-side, the linker region (Lx) has a non-nucleotide structure containing at least one of a pyrrolidine skeleton and a piperidine skeleton, and at least one of the region (X) and the region (Xc) contains the expression inhibitory sequence； (B) a single-stranded nucleic acid molecule containing region (Xc), linker region (Lx), region (X), region (Y), linker region (Ly) and region (Yc) in this order from the 5'-side to the 3'-side, the region (X) and the region (Y) are linked to form inner region (Z), the region (Xc) is complementary to the region (X), the region (Yc) is complementary to the region (Y), the linker region (Lx) and linker region (Ly) each have a non-nucleotide structure containing at least one of a pyrrolidine skeleton and a piperidine skeleton, and the inner region (Z) contains the expression inhibitory sequence.
