600183 Provided is a nucleic acid molecule that binds and/or is complementary to nucleotide sequence: 5'-CUGUUGAGAAA whereby said molecule comprises 23, 24, 25, 26 or 27 nucleotides and comprises or consists of the base sequence of GCCAUUUCUCAACAGAUCUGUCA, wherein optionally one or more of said nucleotides is a nucleotide analogue. The