The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma.
