The invention relates to immunostimulatory oligonucleotides comprising the sequence TCGTCGTTTTACGGCGCCGTTGCCG (SEQ ID NO:44) and to their use in medicine, particularly in the treatment of cancer. The oligonucleotides are useful as adjuvants in vaccination. They are also useful for inducing an immune response and inducing type I interferon (IFN) expression.본 발명은, 시험관내 및 생체내에서, CpG 면역자극 모티프 및 중복 및 고 차원 구조를 포함한 2차 구조를 형성할 수 있는 두번째 모티프를 함유하는 CpG 면역자극 올리고뉴클레오티드 부류에 관한 것이다. 본 발명의 올리고뉴클레오티드는 백신접종에서 아쥬반트로서 유용하다. 올리고뉴클레오티드는 면역 반응을 유도하고, 유형 I 인터페론(IFN)의 발현을 유도하고, 감마 인터페론(IFN-γ)의 발현을 유도하고, 알레르기, 천식, 감염 및 암을 포함한 각종 상태를 치료하기 위해 유용하다.
